Direct Lymph Node Vaccination of Lentivector/Prostate-Specific Antigen is Safe and Generates Tissue-Specific Responses in Rhesus Macaques.

Direct Lymph Node Vaccination of Lentivector/Prostate-Specific Antigen is Safe and Generates Tissue-Specific Responses in Rhesus Macaques.

Anti-cancer immunotherapy is rising from a nadir and demonstrating tangible advantages to sufferers. A wide range of approaches are actually employed. We’re invoking antigen (Ag)-specific responses via direct injections of recombinant lentivectors (LVs) that encode sequences for tumor-associated antigens into a number of lymph nodes to optimize immune presentation/stimulation.
Right here we first exhibit the effectiveness and antigen-specificity of this strategy in mice challenged with prostate-specific antigen (PSA)-expressing tumor cells. Subsequent we examined the protection and efficacy of this strategy in two cohorts of rhesus macaques as a prelude to a medical trial utility.
Our vector encodes the cDNA for rhesus macaque PSA and a rhesus macaque cell floor marker to facilitate vector titering and monitoring. We utilized two unbiased injection schemas demarcated by the timing of LV administration. In each cohorts we noticed marked tissue-specific responses as measured by medical evaluations and magnetic resonance imaging of the prostate gland.
Tissue-specific responses had been sustained for as much as six months-the end-point of the research. Management animals immunized towards an irrelevant Ag had been unaffected. We didn’t observe vector unfold in take a look at or management animals or perturbations of systemic immune parameters. This strategy thus gives an “off-the-shelf” anti-cancer vaccine that could possibly be made at giant scale and injected into patients-even on an out-patient foundation.

Intratumoral Lentivector-Mediated TGF-β1 Gene Downregulation As a Potent Technique for Enhancing the Antitumor Impact of Remedy Composed of Cyclophosphamide and Dendritic Cells.

Vaccination with dendritic cells (DCs) stimulated with tumor antigens can induce particular mobile immune response that acknowledges a excessive spectrum of tumor antigens. Nevertheless, the flexibility of most cancers cells to provide immunosuppressive components drastically decreases the antitumor exercise of DCs.
The principle objective of the research was to enhance the effectiveness of DC-based immunotherapy or chemoimmunotherapy composed of cyclophosphamide (CY) and DCs by utility of lentivectors (LVs)-encoding brief hairpin RNA particular for TGF-β1 (shTGFβ1 LVs). We noticed that s.c. inoculation of each MC38 cells with silenced expression of TGF-β1 (MC38/shTGF-β1) and direct intratumoral utility of shTGFβ1 LVs contributed to discount of suppressor exercise of myeloid cells and Tregs in tumor.
Opposite to expectations, in mice bearing wild tumor, the applying of shTGFβ1 LVs previous to vaccination with bone marrow-derived DC stimulated with tumor antigens (BMDC/TAg) didn’t affect myeloid-derived suppressor cell (MDSC) infiltration into tumor. Because of this, we noticed solely minor MC38 tumor development inhibition (TGI) accompanied by systemic antitumor response activation similar to that obtained for destructive management (shN).
Nevertheless, when the proposed scheme was complemented by pretreatment with a low dose of CY, we seen excessive MC38 TGI along with decreased variety of MDSCs in tumor and induction of Th1-type response. Furthermore, in each schemes of remedy, LVs (shTGFβ1 in addition to shN) induced excessive inflow of CTLs into tumor related in all probability with the viral antigen introduction into tumor microenvironment. Concluding, the applying of shTGFβ1 LVs alone or together with DC-based vaccines just isn’t adequate for long-lasting elimination of suppression in tumor.
Nevertheless, simultaneous discount of TGF-β1 in tumor microenvironment and its transforming by pretreatment with a low dose of CY facilitates the settlement of peritumorally inoculated DCs and helps them in restoration and activation of a potent antitumor response.
Recombinant lentiviral vectors (LVs) are extremely efficient vaccination autos that elicit protecting T cell immunity in illness fashions. Dendritic cells (DCs) purchase antigen at websites of vaccination and migrate to draining lymph nodes, the place they prime vaccine-specific T cells. The efficiency with which LVs activate CD8+ T cell immunity has been attributed to the transduction of DCs on the immunization website and sturdy presentation of LV-encoded antigens.
Nevertheless, it’s not recognized how LV-encoded antigens proceed to be offered to T cells as soon as straight transduced DCs have turned over. Right here, we report that LV-encoded antigen is effectively cross-presented by DCs in vitro. We have now additional exploited the temporal depletion of DCs within the murine CD11c.DTR (diphtheria toxin receptor) mannequin to exhibit that repopulating DCs that had been absent on the time of immunization cross-present LV-encoded antigen to T cells in vivo.
Oblique presentation of antigen from transduced cells by DCs is adequate to prime practical effector T cells that management tumor development. These information recommend that DCs cross-present immunogenic antigen from LV-transduced cells, thereby facilitating extended activation of T cells within the absence of circulating LV particles. These are findings which will affect on the longer term design of LV vaccination methods.

Optimization of a Genome-Broad Disordered Lentivector-Primarily based Brief Hairpin RNA Library.

 

To acquire an entire genome library that suppresses the full variety of human mRNAs, lentiviral vector constructs and a brief hairpin RNA (shRNA) expression cassette had been optimized. The optimization of the vector elevated the virus titer in preparations by 15-20 instances. A easy shRNA construction with a 21-bp stem proved to be the simplest.
Lentivector-based shRNA expression constructs had been obtained through the use of puro(R), copGFP, or H-2K(okay) as a selectable marker. The effectivity of the optimized library was demonstrated when screening for shRNAs reactivating the tumor suppressor p53 in HeLa cells. Cells carried a reporter assemble guaranteeing p53-responsive synthesis of a fluorescent protein, which allowed choice of cells with reactivated p53 by stream cytometry.

Injectable alginate hydrogel for enhanced spatiotemporal management of lentivector supply in murine skeletal muscle.

Hydrogels are an particularly interesting class of biomaterials for gene supply autos as they are often launched into the physique with minimally invasive procedures and are sometimes utilized in tissue engineering and regenerative medication methods. On this research, we present for the primary time using an injectable alginate hydrogel for managed supply of lentivectors within the skeletal muscle of murine hindlimb. We suggest to change the discharge charges of lentivectors via manipulation of the molecular weight distribution of alginate hydrogels.
The discharge of lentivector was examined utilizing two completely different ratios of high and low molecular weight (MW) alginate polymers (75/25 and 25/75 low/excessive MW). The interdependency of lentivector launch fee and alginate degradation fee was assessed in vitro. Lentivector-loaded hydrogels maintained transduction potential for as much as one week in vitro as demonstrated by the continuous transduction of HEK-293T cells.

CENPK Antibody

DF9059 200ul
EUR 304
Description: CENPK Antibody detects endogenous levels of total CENPK.

CENPK siRNA

20-abx911457
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CENPK siRNA

20-abx911458
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CENPK Antibody

ABD9059 100 ug
EUR 438

pENTR223-CENPK

PVT12726 2 ug
EUR 391

CENPK Blocking Peptide

DF9059-BP 1mg
EUR 195

CENPK Conjugated Antibody

C45679 100ul
EUR 397

CENPK cloning plasmid

CSB-CL005214HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 810
  • Sequence: atgaatcaggaggatctagatccggatagtactacagatgtgggagatgttacaaatactgaagaagaacttattagagaatgtgaagaaatgtggaaagatatggaagaatgtcagaataaattatcacttattggaactgaaacactcaccgattcaaatgctcagctatcatt
  • Show more
Description: A cloning plasmid for the CENPK gene.

CENPK Rabbit pAb

A7627-100ul 100 ul
EUR 308

CENPK Rabbit pAb

A7627-200ul 200 ul
EUR 459

CENPK Rabbit pAb

A7627-20ul 20 ul
EUR 183

CENPK Rabbit pAb

A7627-50ul 50 ul
EUR 223

CENPK Polyclonal Antibody

ABP58115-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CENPK protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of CENPK from Human, Mouse. This CENPK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CENPK protein at amino acid sequence of 50-130

CENPK Polyclonal Antibody

ABP58115-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CENPK protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of CENPK from Human, Mouse. This CENPK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CENPK protein at amino acid sequence of 50-130

CENPK Polyclonal Antibody

ABP58115-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CENPK protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of CENPK from Human, Mouse. This CENPK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CENPK protein at amino acid sequence of 50-130

CENPK Polyclonal Antibody

ES9253-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CENPK from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CENPK Polyclonal Antibody

ES9253-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CENPK from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-CENPK antibody

STJ29764 100 µl
EUR 277

Anti-CENPK antibody

STJ190411 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CENPK

Mouse CENPK shRNA Plasmid

20-abx975206
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CENPK shRNA Plasmid

20-abx961921
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CENPK Recombinant Protein (Human)

RP006757 100 ug Ask for price

CENPK Recombinant Protein (Rat)

RP194543 100 ug Ask for price

CENPK Recombinant Protein (Mouse)

RP123488 100 ug Ask for price

CENPK Recombinant Protein (Mouse)

RP123491 100 ug Ask for price

Human Centromere protein K (CENPK)

1-CSB-EP005214HU
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 58.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Centromere protein K(CENPK) expressed in E.coli

Centromere Protein K (CENPK) Antibody

20-abx006672
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Centromere Protein K (CENPK) Antibody

20-abx149226
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Centromere Protein K (CENPK) Antibody

20-abx321953
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Centromere Protein K (CENPK) Antibody

20-abx321954
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cenpk ORF Vector (Rat) (pORF)

ORF064849 1.0 ug DNA
EUR 506

CENPK ORF Vector (Human) (pORF)

ORF002253 1.0 ug DNA
EUR 95

Cenpk ORF Vector (Mouse) (pORF)

ORF041164 1.0 ug DNA
EUR 506

Cenpk ORF Vector (Mouse) (pORF)

ORF041165 1.0 ug DNA
EUR 506

CENPK ELISA Kit (Human) (OKCA00632)

OKCA00632 96 Wells
EUR 833
Description: Description of target: Component of the CENPA-CAD (nucleosome distal) complex, a complex recruited to centromeres which is involved in assembly of kinetochore proteins, mitotic progression and chromosome segregation. May be involved in incorporation of newly synthesized CENPA into centromeres via its interaction with the CENPA-NAC complex. Acts in coordination with CASC5/KNL1 to recruit the NDC80 complex to the outer kinetochore.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.8 pg/mL

Rabbit Anti-Human CENPK polyclonal antibody

CABT-BL124 100 ul
EUR 585

CENPK sgRNA CRISPR Lentivector set (Human)

K0432501 3 x 1.0 ug
EUR 339

Cenpk sgRNA CRISPR Lentivector set (Rat)

K6564001 3 x 1.0 ug
EUR 339

Cenpk sgRNA CRISPR Lentivector set (Mouse)

K3101501 3 x 1.0 ug
EUR 339

Human Centromere protein K(CENPK) ELISA kit

E01C0931-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Centromere protein K(CENPK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Centromere protein K(CENPK) ELISA kit

E01C0931-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Centromere protein K(CENPK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Centromere protein K(CENPK) ELISA kit

E01C0931-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Centromere protein K(CENPK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Centromere protein K(CENPK) ELISA kit

E06C0931-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Centromere protein K(CENPK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Centromere protein K(CENPK) ELISA kit

E06C0931-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Centromere protein K(CENPK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Centromere protein K(CENPK) ELISA kit

E06C0931-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Centromere protein K(CENPK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Centromere protein K(CENPK) ELISA kit

E03C0931-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Centromere protein K(CENPK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Centromere protein K(CENPK) ELISA kit

E03C0931-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Centromere protein K(CENPK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Centromere protein K(CENPK) ELISA kit

E03C0931-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Centromere protein K(CENPK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Centromere protein K(CENPK) ELISA kit

E04C0931-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Centromere protein K(CENPK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Centromere protein K(CENPK) ELISA kit

E04C0931-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Centromere protein K(CENPK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Centromere protein K(CENPK) ELISA kit

E04C0931-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Centromere protein K(CENPK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Centromere protein K(CENPK) ELISA kit

E02C0931-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Centromere protein K(CENPK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Centromere protein K(CENPK) ELISA kit

E02C0931-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Centromere protein K(CENPK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Centromere protein K(CENPK) ELISA kit

E02C0931-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Centromere protein K(CENPK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Centromere protein K(CENPK) ELISA kit

E09C0931-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Centromere protein K(CENPK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Centromere protein K(CENPK) ELISA kit

E09C0931-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Centromere protein K(CENPK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Centromere protein K(CENPK) ELISA kit

E09C0931-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Centromere protein K(CENPK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Centromere protein K(CENPK) ELISA kit

E08C0931-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Centromere protein K(CENPK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Centromere protein K(CENPK) ELISA kit

E08C0931-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Centromere protein K(CENPK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Centromere protein K(CENPK) ELISA kit

E08C0931-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Centromere protein K(CENPK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Centromere protein K(CENPK) ELISA kit

E07C0931-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Centromere protein K(CENPK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Centromere protein K(CENPK) ELISA kit

E07C0931-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Centromere protein K(CENPK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Centromere protein K(CENPK) ELISA kit

E07C0931-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Centromere protein K(CENPK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Centromere protein K, Cenpk ELISA KIT

ELI-11052m 96 Tests
EUR 865

Human Centromere protein K(CENPK) ELISA kit

CSB-EL005214HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Centromere protein K (CENPK) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Centromere protein K(CENPK) ELISA kit

1-CSB-EL005214HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Centromere protein K(CENPK) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Centromere protein K, CENPK ELISA KIT

ELI-34111h 96 Tests
EUR 824

Chicken Centromere protein K, CENPK ELISA KIT

ELI-34204c 96 Tests
EUR 928

CENPK sgRNA CRISPR Lentivector (Human) (Target 1)

K0432502 1.0 ug DNA
EUR 154

CENPK sgRNA CRISPR Lentivector (Human) (Target 2)

K0432503 1.0 ug DNA
EUR 154

CENPK sgRNA CRISPR Lentivector (Human) (Target 3)

K0432504 1.0 ug DNA
EUR 154

Cenpk sgRNA CRISPR Lentivector (Rat) (Target 1)

K6564002 1.0 ug DNA
EUR 154

Cenpk sgRNA CRISPR Lentivector (Rat) (Target 2)

K6564003 1.0 ug DNA
EUR 154

Cenpk sgRNA CRISPR Lentivector (Rat) (Target 3)

K6564004 1.0 ug DNA
EUR 154

Cenpk sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3101502 1.0 ug DNA
EUR 154

Cenpk sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3101503 1.0 ug DNA
EUR 154

Cenpk sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3101504 1.0 ug DNA
EUR 154

CENPK Protein Vector (Mouse) (pPB-C-His)

PV164654 500 ng
EUR 603

CENPK Protein Vector (Mouse) (pPB-N-His)

PV164655 500 ng
EUR 603

CENPK Protein Vector (Mouse) (pPM-C-HA)

PV164656 500 ng
EUR 603

CENPK Protein Vector (Mouse) (pPM-C-His)

PV164657 500 ng
EUR 603

CENPK Protein Vector (Mouse) (pPB-C-His)

PV164658 500 ng
EUR 603

CENPK Protein Vector (Mouse) (pPB-N-His)

PV164659 500 ng
EUR 603

CENPK Protein Vector (Mouse) (pPM-C-HA)

PV164660 500 ng
EUR 603

CENPK Protein Vector (Mouse) (pPM-C-His)

PV164661 500 ng
EUR 603

CENPK Protein Vector (Rat) (pPB-C-His)

PV259394 500 ng
EUR 603

CENPK Protein Vector (Rat) (pPB-N-His)

PV259395 500 ng
EUR 603

CENPK Protein Vector (Rat) (pPM-C-HA)

PV259396 500 ng
EUR 603

CENPK Protein Vector (Rat) (pPM-C-His)

PV259397 500 ng
EUR 603

CENPK Protein Vector (Human) (pPB-C-His)

PV009009 500 ng
EUR 329

CENPK Protein Vector (Human) (pPB-N-His)

PV009010 500 ng
EUR 329

CENPK Protein Vector (Human) (pPM-C-HA)

PV009011 500 ng
EUR 329

CENPK Protein Vector (Human) (pPM-C-His)

PV009012 500 ng
EUR 329

Cenpk 3'UTR GFP Stable Cell Line

TU153719 1.0 ml Ask for price

Cenpk 3'UTR Luciferase Stable Cell Line

TU103719 1.0 ml Ask for price

Cenpk 3'UTR Luciferase Stable Cell Line

TU202175 1.0 ml Ask for price
Injection of lentivector-loaded hydrogel in vivo led to a sustained stage of transgene expression for greater than two months whereas minimizing the copies of lentivirus genome inserted into the genome of murine skeletal muscle cells. This technique of spatiotemporal management of lentivector supply from alginate hydrogels might present a flexible instrument to mix gene remedy and biomaterials for functions in regenerative medication.

Leave a Reply

Your email address will not be published. Required fields are marked *