Lentivector Knockdown of CCR5 in Hematopoietic Stem and Progenitor Cells Confers Functional and Persistent HIV-1 Resistance in Humanized Mice.

Lentivector Knockdown of CCR5 in Hematopoietic Stem and Progenitor Cells Confers Functional and Persistent HIV-1 Resistance in Humanized Mice.

Gene-engineered CD34(+) hematopoietic stem and progenitor cells (HSPCs) can be utilized to generate an HIV-1-resistant immune system. Nevertheless, a sure threshold of transduced HSPCs is perhaps required for transplantation into mice for creating an HIV-resistant immune system.
On this examine, we mixed CCR5 knockdown by a extremely environment friendly microRNA (miRNA) lentivector with pretransplantation number of transduced HSPCs to acquire a reasonably pure inhabitants of gene engineered CD34(+) cells. Low-level transduction of HSPCs and subsequent sorting by circulate cytometry yielded >70% transduced cells.
Mice transplanted with these cells confirmed purposeful and protracted resistance to a CCR5-tropic HIV pressure: viral load was considerably decreased over months, and human CD4(+) T cells had been preserved. In a single mouse, viral mutations, ensuing presumably in a CXCR4-tropic pressure, overcame HIV resistance. Our outcomes recommend that HSPC-based CCR5 knockdown could result in environment friendly management of HIV in vivo.
We overcame a serious limitation of earlier HIV gene remedy in humanized mice wherein solely a proportion of the cells in chimeric mice in vivo are anti-HIV engineered. Our technique underlines the promising way forward for gene engineering HIV-resistant CD34(+) cells that produce a relentless provide of HIV-resistant progeny.

Lengthy-term central and effector SHIV-specific reminiscence T cell responses elicited after a single immunization with a novel lentivector DNA vaccine.

Prevention of HIV acquisition and replication requires lengthy lasting and efficient immunity. Given the state of HIV vaccine improvement, progressive vectors and immunization methods are urgently wanted to generate secure and efficacious HIV vaccines.
Right here, we developed a novel lentivirus-based DNA vector that doesn’t combine within the host genome and undergoes a single-cycle of replication. Viral proteins are constitutively expressed below the management of Tat-independent LTR promoter from goat lentivirus. We immunized six macaques as soon as solely with CAL-SHIV-IN- DNA utilizing mixed intramuscular and intradermal injections plus electroporation.
Antigen-specific T cell responses had been monitored for 47 weeks post-immunization (PI). PBMCs had been assessed straight ex vivo or after 6 and 12 days of in vitro tradition utilizing antigenic and/or homeostatic proliferation. IFN-γ ELISPOT was used to measure speedy cytokine secretion from antigen particular effector cells and from reminiscence precursors with excessive proliferative capability (PHPC).
The reminiscence phenotype and capabilities (proliferation, cytokine expression, lytic content material) of particular T cells had been examined utilizing multiparametric FACS-based assays. All immunized macaques developed lasting peripheral CD8+ and CD4+ T cell responses primarily in opposition to Gag and Nef antigens.
Throughout the major enlargement part, speedy effector cells in addition to growing numbers of proliferating cells with restricted effector capabilities had been detected which expressed markers of effector (EM) and central (CM) reminiscence phenotypes.
These responses contracted however then reemerged later in absence of antigen enhance. Sturdy PHPC responses comprising vaccine-specific CM and EM T cells that readily expanded and purchased speedy effector capabilities had been detected at 40/47 weeks PI. Altogether, our examine demonstrated {that a} single immunization with a replication-limited DNA vaccine elicited persistent vaccine-specific CM and EM CD8+ and CD4+ T cells with speedy and readily inducible effector capabilities, within the absence of ongoing antigen expression.
To extend the security and probably efficacy of HIV-1 derived lentivectors (LVs) as an anti-cancer vaccine, we not too long ago developed the Nanobody (Nb) show know-how to focus on LVs to antigen presenting cells (APCs). On this examine, we prolong these knowledge with unique focusing on of LVs to traditional dendritic cells (DCs), that are believed to be the principle cross-presenting APCs for the induction of a TH1-conducted antitumor immune response.
The immunogenicity of those DC-subtype focused LVs was in comparison with that of broad tropism, common APC-targeted and non-infectious LVs. Intranodal immunization with ovalbumin encoding LVs induced proliferation of antigen particular CD4+ T cells, regardless of the LVs’ focusing on capacity.
Nevertheless, the cytokine secretion profile of the restimulated CD4+ T cells demonstrated that common APC focusing on induced an analogous TH1-profile because the broad tropism LVs whereas transduction of standard DCs alone induced an analogous and fewer potent TH1 profile because the non-infectious LVs. This commentary contradicts the speculation that standard DCs are crucial APCs and means that the activation of different APCs can also be significant.
Regardless of these variations, all focused LVs had been capable of stimulate cytotoxic T lymphocytes, be it to a lesser extent than broad tropism LVs. Moreover this induction was proven to be depending on sort I interferon for the focused and non-infectious LVs, however not for broad tropism LVs. Lastly we demonstrated that the APC-targeted LVs had been as potent in remedy as broad tropism LVs and as such ship on their promise as safer and efficacious LV-based vaccines.
As sentinels of the immune system, dendritic cells (DCs) play a necessary function in regulating mobile immune responses. One of many foremost challenges of creating DC-targeted therapies contains the supply of antigen to DCs with the intention to promote the activation of antigen-specific effector CD8 T cells.
With the objective of making antigen-directed immunotherapeutics that may be safely administered on to sufferers, Immune Design has developed a platform of novel integration-deficient lentiviral vectors that focus on and ship antigen-encoding nucleic acids to human DCs.
Lentivector Knockdown of CCR5 in Hematopoietic Stem and Progenitor Cells Confers Functional and Persistent HIV-1 Resistance in Humanized Mice.
This platform, termed ID-VP02, makes use of a novel genetic variant of a Sindbis virus envelope glycoprotein with posttranslational carbohydrate modifications together with Vpx, a SIVmac viral accent protein, to attain environment friendly focusing on and transduction of human DCs. As well as, ID-VP02 incorporates security options in its design that embrace two redundant mechanisms to render ID-VP02 integration-deficient.
Right here, we describe the traits that enable ID-VP02 to particularly transduce human DCs, and the advances that ID-VP02 brings to traditional third-generation lentiviral vector design in addition to exhibit upstream manufacturing yields that can allow manufacturing feasibility research to be performed.

Cell-cell transmission of VSV-G pseudotyped lentivector particles

Many replicating viruses, together with HIV-1 and HTLV-1, are effectively transmitted from the cell floor of actively contaminated cells upon contact with bystander cells. In a earlier examine, we reported the extended cell floor retention of VSV-G replication-deficient pseudotyped lentivector previous to endocytic entry. Nevertheless, the competing kinetics of cell floor versus dissociation, neutralization or direct switch to different cells have acquired comparatively little consideration.
Right here we exhibit that the relative effectivity of cell-cell floor transmission can outpace “cell-free” transduction at limiting vector enter. This coincides with the extended half-life of cell certain vector however happens, in contrast to HTLV-1, with out proof for particle aggregation.

C1orf43 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV707943 1.0 ug DNA
EUR 316

C1orf43 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV707947 1.0 ug DNA
EUR 316

C1orf43 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV707948 1.0 ug DNA
EUR 316

C1orf43 ORF Vector (Human) (pORF)

ORF001431 1.0 ug DNA
EUR 95

C1orf43 ORF Vector (Human) (pORF)

ORF001432 1.0 ug DNA
EUR 95

C1ORF43 Blocking Peptide

33R-10211 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of C1orf43 antibody, catalog no. 70R-3822

C1orf43 cloning plasmid

CSB-CL874824HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 762
  • Sequence: atggcgtccggcagtaactggctctccggggtgaatgtcgtgctggtgatggcctacgggagcctggtgtttgtactgctatttatttttgtgaagaggcaaatcatgcgctttgcaatgaaatctcgaaggggacctcatgtccctgtgggacacaatgcccccaaggacttgaa
  • Show more
Description: A cloning plasmid for the C1orf43 gene.

C1orf43 cloning plasmid

CSB-CL874824HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 570
  • Sequence: atggcgtccggcagtaactggctctccggggtgaatgtcgtgctggtgatggcctacgggagcctggtgtttgtactgctatttatttttgtgaagaggcaaatcatgcgctttgcaatgaaatctcgaaggggacctcatgtccctgtgggacacaatgcccccaaggacttgaa
  • Show more
Description: A cloning plasmid for the C1orf43 gene.

pCMV-SPORT6-C1orf43

PVT12431 2 ug
EUR 391

Human C1orf43 shRNA Plasmid

20-abx958583
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pECMV-3-FLAG-C1orf43

PVT13021 2 ug
EUR 325

C1orf43 Recombinant Protein (Human)

RP004291 100 ug Ask for price

C1orf43 Recombinant Protein (Human)

RP004294 100 ug Ask for price

C1orf43 Protein Vector (Human) (pPB-His-MBP)

PV330078 500 ng
EUR 329

C1orf43 Protein Vector (Human) (pPB-His-GST)

PV330079 500 ng
EUR 329

C1orf43 Protein Vector (Human) (pPB-His-MBP)

PV330082 500 ng
EUR 329

C1orf43 Protein Vector (Human) (pPB-His-GST)

PV330083 500 ng
EUR 329

C1orf43 Protein Vector (Human) (pPB-C-His)

PV005721 500 ng
EUR 329

C1orf43 Protein Vector (Human) (pPB-N-His)

PV005722 500 ng
EUR 329

C1orf43 Protein Vector (Human) (pPM-C-HA)

PV005723 500 ng
EUR 329

C1orf43 Protein Vector (Human) (pPM-C-His)

PV005724 500 ng
EUR 329

C1orf43 Protein Vector (Human) (pPB-C-His)

PV005725 500 ng
EUR 329

C1orf43 Protein Vector (Human) (pPB-N-His)

PV005726 500 ng
EUR 329

C1orf43 Protein Vector (Human) (pPM-C-HA)

PV005727 500 ng
EUR 329

C1orf43 Protein Vector (Human) (pPM-C-His)

PV005728 500 ng
EUR 329

C1orf43 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV707944 1.0 ug DNA
EUR 316

C1orf43 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV707945 1.0 ug DNA
EUR 374

C1orf43 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV707946 1.0 ug DNA
EUR 374

C1orf43 sgRNA CRISPR Lentivector set (Human)

K0205701 3 x 1.0 ug
EUR 339

C1orf43 Protein Vector (Human) (pPM-N-D-C-HA)

PV330080 500 ng
EUR 552

C1orf43 Protein Vector (Human) (pPM-N-D-C-His)

PV330081 500 ng
EUR 552

C1orf43 Protein Vector (Human) (pPM-N-D-C-HA)

PV330084 500 ng
EUR 552

C1orf43 Protein Vector (Human) (pPM-N-D-C-His)

PV330085 500 ng
EUR 552

C1orf43 sgRNA CRISPR Lentivector (Human) (Target 1)

K0205702 1.0 ug DNA
EUR 154

C1orf43 sgRNA CRISPR Lentivector (Human) (Target 2)

K0205703 1.0 ug DNA
EUR 154

C1orf43 sgRNA CRISPR Lentivector (Human) (Target 3)

K0205704 1.0 ug DNA
EUR 154

C1orf43 3'UTR GFP Stable Cell Line

TU052013 1.0 ml
EUR 1521

C1orf43 3'UTR Luciferase Stable Cell Line

TU002013 1.0 ml
EUR 1521

C1orf43 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0205705 3 x 1.0 ug
EUR 376

C1orf43 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0205706 1.0 ug DNA
EUR 167

C1orf43 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0205707 1.0 ug DNA
EUR 167

C1orf43 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0205708 1.0 ug DNA
EUR 167

dCas9-KRAB Lentiviral Vector

K203 10 ug
EUR 228

Cas9 Nuclease Lentiviral Vector

K002 10 ug
EUR 154

Cas9 Nickase Lentiviral Vector

K005 10 ug
EUR 154

pSMPUW-MNDnLacZ Lentiviral Control Vector

LTV-402 10 µg
EUR 618
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pLenti-GFP Lentiviral Control Vector

LTV-400 100 µL
EUR 618
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pSMPUW-Puro Lentiviral Expression Vector

VPK-212 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-Neo Lentiviral Expression Vector

VPK-213 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-Hygro Lentiviral Expression Vector

VPK-214 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pLenti-RFP-Puro Lentiviral Control Vector

LTV-403 100 µL
EUR 618
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pSMPUW-GFP-LC3 Lentiviral Expression Vector

LTV-801 10 µg
EUR 1204
Description: Expression vector contains a fusion of GFP and LC3. A separate GFP control vector is also included.

ESR1 Lentiviral Vector (Human) (pLenti-II)

LV010008 1.0 ug DNA
EUR 316

pSMPUW-GFP-Puro Lentiviral Control Vector

LTV-401 10 µg
EUR 618
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pSMPUW Universal Lentiviral Expression Vector (Promoterless)

VPK-211 10 µg
EUR 624
Description: Clone your gene of interest and a gene-specific promoter into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293T or 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-IRES-Puro Lentiviral Expression Vector

VPK-215 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-IRES-Neo Lentiviral Expression Vector

VPK-216 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-IRES-Hygro Lentiviral Expression Vector

VPK-217 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-IRES-Blasticidin Lentiviral Expression Vector

VPK-219 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

DPY19L1P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723333 1.0 ug DNA Ask for price

DPY19L1P2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723334 1.0 ug DNA Ask for price

DRD5P1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723353 1.0 ug DNA Ask for price

DRD5P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723357 1.0 ug DNA Ask for price

DRD5P1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723358 1.0 ug DNA Ask for price

DRD5P2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723359 1.0 ug DNA Ask for price

DRD5P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723363 1.0 ug DNA Ask for price

DRD5P2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723364 1.0 ug DNA Ask for price

DSTNP1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723383 1.0 ug DNA Ask for price

DSTNP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723387 1.0 ug DNA Ask for price

DSTNP1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723388 1.0 ug DNA Ask for price

DSTNP3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723389 1.0 ug DNA Ask for price

DSTNP3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723393 1.0 ug DNA Ask for price

DSTNP3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723394 1.0 ug DNA Ask for price

DTX2P1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723395 1.0 ug DNA Ask for price

DTX2P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723399 1.0 ug DNA Ask for price

DTX2P1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723400 1.0 ug DNA Ask for price

DURS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723401 1.0 ug DNA Ask for price

DURS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723405 1.0 ug DNA Ask for price

DURS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723406 1.0 ug DNA Ask for price

DUSPP Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723407 1.0 ug DNA Ask for price

DUSPP Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723411 1.0 ug DNA Ask for price

DUSPP Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723412 1.0 ug DNA Ask for price

DUTP1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723413 1.0 ug DNA Ask for price

DUTP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723417 1.0 ug DNA Ask for price

DUTP1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723418 1.0 ug DNA Ask for price

DUTP2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723419 1.0 ug DNA Ask for price

DUTP2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723423 1.0 ug DNA Ask for price

DUTP2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723424 1.0 ug DNA Ask for price

DUTP4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723425 1.0 ug DNA Ask for price

DUTP4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723429 1.0 ug DNA Ask for price

DUTP4 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723430 1.0 ug DNA Ask for price

DUTP5 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723431 1.0 ug DNA Ask for price

DUTP5 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723435 1.0 ug DNA Ask for price

DUTP5 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723436 1.0 ug DNA Ask for price

DUTP6 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723437 1.0 ug DNA Ask for price

DUTP6 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723441 1.0 ug DNA Ask for price
These research recommend that cell-surface attachment stabilizes particles and alters neutralization kinetics. Our experiments present novel perception into the underexplored cell-cell transmission of pseudotyped particles.

Leave a Reply

Your email address will not be published. Required fields are marked *