Functional rescue in an Angelman syndrome model following treatment with lentivector transduced hematopoietic stem cells

Functional rescue in an Angelman syndrome model following treatment with lentivector transduced hematopoietic stem cells

Angelman Syndrome is a uncommon neurodevelopmental dysfunction characterised by impaired communication expertise, ataxia, motor and steadiness deficits, mental disabilities, and seizures. The genetic reason for Angelman syndrome is the neuronal lack of UBE3A expression within the mind.
A novel method, described right here, is a stem cell gene remedy which makes use of lentivector transduced hematopoietic stem and progenitor cells to ship useful UBE3A to affected cells. We have now demonstrated each the prevention and reversal of Angelman syndrome phenotypes upon transplantation and engraftment of human CD34+ cells transduced with a Ube3a lentivector in a novel immunodeficient Ube3amat-/pat+ IL2rg-/y mouse mannequin of Angelman syndrome.
A major enchancment in motor and cognitive behavioral assays in addition to normalized delta energy measured by EEG was noticed in neonates and adults transplanted with the gene modified cells. Human hematopoietic profiles noticed within the lymphoid organs by detection of human immune cells had been regular.
Expression of UBE3A was detected within the brains of the grownup therapy group following immunohistochemical staining illustrating engraftment of the gene modified cells expressing UBE3A within the mind. As demonstrated with our information, this stem cell gene remedy method affords a promising therapy technique for Angelman syndrome, not requiring a vital therapy window.

ZVex™, a dendritic-cell-tropic lentivector, primes protecting antitumor T cell responses which can be considerably boosted utilizing heterologous vaccine modalities

Therapeutic most cancers vaccines should induce excessive ranges of tumor-specific cytotoxic CD8 T cells to be efficient. We present right here that tumor-antigen particular effector and reminiscence T cell responses primed with a non-integrating, dendritic-cell focused lentiviral vector (ZVex™) could possibly be boosted considerably by both adjuvanted recombinant protein, adenoviral vectors, or self-replicating RNA.
These heterologous prime-boost regimens additionally supplied considerably higher safety in murine tumor fashions. In distinction, homologous prime-boost regimens, or utilizing the lentiviral vector as a lift, resulted in decrease T cell responses with restricted therapeutic efficacy. Heterologous prime-boost regimens that make the most of ZVex because the prime could also be enticing modalities for therapeutic most cancers vaccines.

Extremely environment friendly ‘hit-and-run’ genome modifying with unconcentrated lentivectors carrying Vpr.Prot.Cas9 protein produced from RRE-containing transcripts

The appliance of gene-editing know-how is presently restricted by the dearth of protected and environment friendly strategies to ship RNA-guided endonucleases to focus on cells. We engineered lentivirus-based nanoparticles to co-package the U6-sgRNA template and the CRISPR-associated protein 9 (Cas9) fused with a virion-targeted protein Vpr (Vpr.Prot.Cas9), for simultaneous supply to cells.
Equal spatiotemporal management of the vpr.prot.cas9 and gag/pol gene expression (the presence of Rev responsive aspect, RRE) drastically enhanced the encapsidation of the fusion protein and resulted within the manufacturing of extremely environment friendly lentivector nanoparticles. Transduction of the unconcentrated, Vpr.Prot.Cas9-containing vectors led to >98% disruption of the EGFP gene in reporter HEK293-EGFP cells with minimal cytotoxicity.
Moreover, we detected indels within the focused endogenous loci at frequencies of as much as 100% in cell traces derived from lymphocytes and monocytes and as much as 15% in major CD4+ T cells by high-throughput sequencing. This method might present a platform for the environment friendly, dose-controlled and tissue-specific supply of genome modifying enzymes to cells and it could be appropriate for simultaneous endogenous gene disruption and a transgene supply.

A single lentivector DNA based mostly immunization accommodates a late heterologous SIVmac251 mucosal problem an infection.

Number of typical vaccine methods examined towards HIV-1 have did not induce safety towards HIV acquisition or sturdy management of viremia. Subsequently, modern methods that may induce lengthy lasting protecting immunity towards HIV continual an infection are wanted. Lately, we developed an integration-defective HIV lentiDNA vaccine that undergoes a single cycle of replication in goal cells wherein most viral antigens are produced.
A single immunization with such lentiDNA induced long-lasting T-cell and modest antibody responses in cynomolgus macaques. Right here eighteen months after this single immunization, all animals had been subjected to repeated low dose intra-rectal challenges with a heterologous pathogenic SIVmac251 isolate.
Though the viral set level in SIVmac-infected cynomolgus is often decrease than that seen in Indian rhesus macaques, the vaccinated group of macaques displayed a two log discount of peak of viremia adopted by a progressive and sustained management of virus replication relative to manage animals.
This antiviral management correlated with antigen-specific CD4+ and CD8+ T cells with excessive capability of recall responses comprising effector and central reminiscence T cells but additionally reminiscence T cell precursors. That is the primary description of SIV management in NHP mannequin contaminated at 18 months following a single immunization with a non-integrative single cycle lentiDNA HIV vaccine.
Whereas not delivering sterilizing immunity, our single immunization technique with a single-cycle lentivector DNA vaccine seems to offer an fascinating and protected vaccine platform that warrants additional exploration.

Use of Heterologous Vesiculovirus G Proteins Circumvents the Humoral Anti-envelope Immunity in Lentivector-Primarily based In Vivo Gene Supply.

Vesicular stomatitis virus Indiana pressure glycoprotein (VSVind.G) mediates broad tissue tropism and environment friendly mobile uptake. Lentiviral vectors (LVs) are notably promising, as they’ll effectively transduce non-dividing cells and facilitate steady genomic transgene integration; due to this fact, LVs have an infinite untapped potential for gene remedy purposes, however the improvement of humoral and cell-mediated anti-vector responses might prohibit their efficacy.
We hypothesized that G proteins from totally different members of the vesiculovirus genus may enable the technology of a panel of serotypically distinct LV pseudotypes with potential for repeated in vivo administration.
Functional rescue in an Angelman syndrome model following treatment with lentivector transduced hematopoietic stem cells
We discovered that mice hyperimmunized with VSVind.G weren’t transduced to any important diploma following intravenous injection of LVs with VSVind.G envelopes, in keeping with the thesis that a number of LV administrations would doubtless be blunted by an adaptive immune response.
Excitingly, bioluminescence imaging research demonstrated that the VSVind-neutralizing response could possibly be evaded by LV pseudotyped with Piry and, to a lesser extent, Cocal virus glycoproteins. Heterologous dosing regimens utilizing viral vectors and oncolytic viruses with Piry and Cocal envelopes might signify a novel technique to attain repeated vector-based interventions, unfettered by pre-existing anti-envelope antibodies.

Characterizing the encapsulation and launch of lentivectors and adeno-associated vectors from degradable alginate hydrogels.

Gene remedy utilizing viral vectors has been licensed for scientific use each within the European Union and the USA. Lentivectors (LV) and adeno-associated vectors (AAV) are two promising and FDA accredited gene-therapy viral vectors. Many future purposes of those vectors will profit from focusing on particular areas of curiosity throughout the physique.
Subsequently, constructing on the early success of those vectors might rely upon discovering efficient supply programs to localize therapeutic administration. Degradable alginate hydrogels have been examined as interesting supply automobiles for the managed supply of vector payloads. On this research, we examine the flexibility of two totally different degradable alginate hydrogel formulations to effectively ship LV and AAV.
We suggest that launch charges of viral vectors are depending on the bodily properties of each the hydrogels and vectors. Right here, we reveal that the preliminary power and degradation charge of alginate hydrogels supplies levers of management for tuning LV launch however don’t present management within the launch of AAV.
Whereas each alginate formulations used confirmed sustained launch of each LV and AAV, LV launch was proven to be depending on alginate hydrogel degradation, whereas AAV launch was largely ruled by diffusive mechanisms.

MCOLN1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV623711 1.0 ug DNA
EUR 682

MCOLN1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV623712 1.0 ug DNA
EUR 682

Mcoln1 ORF Vector (Rat) (pORF)

ORF070382 1.0 ug DNA
EUR 506

MCOLN1 ORF Vector (Human) (pORF)

ORF006340 1.0 ug DNA
EUR 95

Mcoln1 ORF Vector (Mouse) (pORF)

ORF049952 1.0 ug DNA
EUR 506

MCOLN1 cloning plasmid

CSB-CL872417HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1743
  • Sequence: atgacagccccggcgggtccgcgcggctcagagaccgagcggcttctgacccccaaccccgggtatgggacccaggcggggccttcaccggcccctccgacacccccagaagaggaagaccttcgccgtcgtctcaaatactttttcatgagtccctgcgacaagtttcgagcca
  • Show more
Description: A cloning plasmid for the MCOLN1 gene.

Mucolipin 1 (MCOLN1) Antibody

abx027461-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mucolipin 1 (MCOLN1) Antibody

abx027461-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

MCOLN1 ELISA KIT|Human

EF005299 96 Tests
EUR 689

Human MCOLN1 shRNA Plasmid

20-abx961390
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MCOLN1 shRNA Plasmid

20-abx979279
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MCOLN1 Recombinant Protein (Human)

RP019018 100 ug Ask for price

MCOLN1 Recombinant Protein (Mouse)

RP149852 100 ug Ask for price

MCOLN1 Recombinant Protein (Rat)

RP211142 100 ug Ask for price

MCOLN1 Protein Vector (Rat) (pPB-C-His)

PV281526 500 ng
EUR 603

MCOLN1 Protein Vector (Rat) (pPB-N-His)

PV281527 500 ng
EUR 603

MCOLN1 Protein Vector (Rat) (pPM-C-HA)

PV281528 500 ng
EUR 603

MCOLN1 Protein Vector (Rat) (pPM-C-His)

PV281529 500 ng
EUR 603

MCOLN1 Protein Vector (Mouse) (pPB-C-His)

PV199806 500 ng
EUR 603

MCOLN1 Protein Vector (Mouse) (pPB-N-His)

PV199807 500 ng
EUR 603

MCOLN1 Protein Vector (Mouse) (pPM-C-HA)

PV199808 500 ng
EUR 603

MCOLN1 Protein Vector (Mouse) (pPM-C-His)

PV199809 500 ng
EUR 603

MCOLN1 Protein Vector (Human) (pPB-C-His)

PV025357 500 ng
EUR 329

MCOLN1 Protein Vector (Human) (pPB-N-His)

PV025358 500 ng
EUR 329

MCOLN1 Protein Vector (Human) (pPM-C-HA)

PV025359 500 ng
EUR 329

MCOLN1 Protein Vector (Human) (pPM-C-His)

PV025360 500 ng
EUR 329

MCOLN1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV623708 1.0 ug DNA
EUR 682

MCOLN1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV623709 1.0 ug DNA
EUR 740

MCOLN1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV623710 1.0 ug DNA
EUR 740

Human Mucolipin 1 (MCOLN1)ELISA Kit

201-12-2918 96 tests
EUR 440
  • This Mucolipin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Mucolipin- 1, MCOLN1 ELISA KIT

ELI-16341h 96 Tests
EUR 824

Mouse Mucolipin- 1, Mcoln1 ELISA KIT

ELI-19579m 96 Tests
EUR 865

Human Mucolipin 1 (MCOLN1) ELISA Kit

abx385174-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Mucolipin 1 (MCOLN1) ELISA Kit

abx389933-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mcoln1 sgRNA CRISPR Lentivector set (Rat)

K6717101 3 x 1.0 ug
EUR 339

MCOLN1 sgRNA CRISPR Lentivector set (Human)

K1281301 3 x 1.0 ug
EUR 339

Mcoln1 sgRNA CRISPR Lentivector set (Mouse)

K4111301 3 x 1.0 ug
EUR 339

Human Mucolipin 1(MCOLN1)ELISA Kit

QY-E00280 96T
EUR 361

Mcoln1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6717102 1.0 ug DNA
EUR 154

Mcoln1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6717103 1.0 ug DNA
EUR 154

Mcoln1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6717104 1.0 ug DNA
EUR 154

MCOLN1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1281302 1.0 ug DNA
EUR 154

MCOLN1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1281303 1.0 ug DNA
EUR 154

MCOLN1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1281304 1.0 ug DNA
EUR 154

Mcoln1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4111302 1.0 ug DNA
EUR 154

Mcoln1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4111303 1.0 ug DNA
EUR 154

Mcoln1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4111304 1.0 ug DNA
EUR 154

Mcoln1 3'UTR Luciferase Stable Cell Line

TU113005 1.0 ml Ask for price

Mcoln1 3'UTR GFP Stable Cell Line

TU163005 1.0 ml Ask for price

Mcoln1 3'UTR Luciferase Stable Cell Line

TU212969 1.0 ml Ask for price

Mcoln1 3'UTR GFP Stable Cell Line

TU262969 1.0 ml Ask for price

MCOLN1 3'UTR GFP Stable Cell Line

TU063133 1.0 ml
EUR 1394

MCOLN1 3'UTR Luciferase Stable Cell Line

TU013133 1.0 ml
EUR 1394

Mcoln1 ELISA Kit| Mouse Mucolipin-1 ELISA Kit

EF015572 96 Tests
EUR 689

Mcoln1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6717105 3 x 1.0 ug
EUR 376

MCOLN1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1281305 3 x 1.0 ug
EUR 376

Mcoln1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4111305 3 x 1.0 ug
EUR 376

Mcoln1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6717106 1.0 ug DNA
EUR 167

Mcoln1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6717107 1.0 ug DNA
EUR 167

Mcoln1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6717108 1.0 ug DNA
EUR 167

MCOLN1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1281306 1.0 ug DNA
EUR 167

MCOLN1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1281307 1.0 ug DNA
EUR 167

MCOLN1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1281308 1.0 ug DNA
EUR 167

Mcoln1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4111306 1.0 ug DNA
EUR 167

Mcoln1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4111307 1.0 ug DNA
EUR 167

Mcoln1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4111308 1.0 ug DNA
EUR 167

dCas9-KRAB Lentiviral Vector

K203 10 ug
EUR 228

Cas9 Nuclease Lentiviral Vector

K002 10 ug
EUR 154

Cas9 Nickase Lentiviral Vector

K005 10 ug
EUR 154

pSMPUW-MNDnLacZ Lentiviral Control Vector

LTV-402 10 µg
EUR 618
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pLenti-GFP Lentiviral Control Vector

LTV-400 100 µL
EUR 618
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pSMPUW-Puro Lentiviral Expression Vector

VPK-212 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-Neo Lentiviral Expression Vector

VPK-213 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-Hygro Lentiviral Expression Vector

VPK-214 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pLenti-RFP-Puro Lentiviral Control Vector

LTV-403 100 µL
EUR 618
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pSMPUW-GFP-LC3 Lentiviral Expression Vector

LTV-801 10 µg
EUR 1204
Description: Expression vector contains a fusion of GFP and LC3. A separate GFP control vector is also included.

ESR1 Lentiviral Vector (Human) (pLenti-II)

LV010008 1.0 ug DNA
EUR 316

pSMPUW-GFP-Puro Lentiviral Control Vector

LTV-401 10 µg
EUR 618
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pSMPUW Universal Lentiviral Expression Vector (Promoterless)

VPK-211 10 µg
EUR 624
Description: Clone your gene of interest and a gene-specific promoter into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293T or 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-IRES-Puro Lentiviral Expression Vector

VPK-215 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-IRES-Neo Lentiviral Expression Vector

VPK-216 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-IRES-Hygro Lentiviral Expression Vector

VPK-217 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-IRES-Blasticidin Lentiviral Expression Vector

VPK-219 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

DPY19L1P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723333 1.0 ug DNA Ask for price

DPY19L1P2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723334 1.0 ug DNA Ask for price

DRD5P1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723353 1.0 ug DNA Ask for price

DRD5P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723357 1.0 ug DNA Ask for price

DRD5P1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723358 1.0 ug DNA Ask for price

DRD5P2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723359 1.0 ug DNA Ask for price

DRD5P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723363 1.0 ug DNA Ask for price

DRD5P2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723364 1.0 ug DNA Ask for price

DSTNP1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723383 1.0 ug DNA Ask for price

DSTNP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723387 1.0 ug DNA Ask for price

DSTNP1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723388 1.0 ug DNA Ask for price

DSTNP3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723389 1.0 ug DNA Ask for price

DSTNP3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723393 1.0 ug DNA Ask for price
Altogether, this research demonstrates alginate’s use as a attainable supply platform for LV and, for the primary time, AAV – highlighting the potential of injectable degradable alginate hydrogels for use as a flexible supply software in gene remedy purposes.

Leave a Reply

Your email address will not be published. Required fields are marked *